Ciężki zakaźny zespół mononukleozopodobny i pierwotny ludzki wirus opryszczki 6 Zakażenie u dorosłych ad

Zmiany skórne uległy koalescencji, a rozlany rumień rozwinął się na całym ciele. Metyloprednizolon (250 mg na dobę) podawano przez trzy dni, począwszy od siódmego dnia hospitalizacji. Zaobserwowano zmniejszenie liczby atypowych limfocytów. Wyleczył się skórny wybuch z obfitą błoniastą eksfoliacją, a symptomy podobne do mononukleozy stopniowo zanikły. Pacjent został odesłany do domu w 58. dniu pobytu w szpitalu i nie miał żadnych następstw klinicznych. Metody
Analiza fenotypowa nietypowych limfocytów
Jednojądrzaste komórki krwi obwodowej (PBMC) rozdzielano wirowaniem w gradiencie gęstości Ficoll-Hypaque. Niepadherentne PBMC były fenotypowane na cytometrze przepływowym FACSort (Becton Dickinson, Mountain View, CA), z użyciem monoklonalnych przeciwciał skoniugowanych z fluoresceiną lub fikoerytryną, w tym T11 (CD2), Leu-4 (CD3), Leu-3a ( CD4), Leu-9 (CD7), Leu-2a (CD8), Leu-11 (CD16), NKH-1 (CD56), anty-HLA-DR i MY10 (CD34) (wszystkie z Becton Dickinson) i J5 (CD10), MY7 (CD13), B4 (CD19), B1 (CD20) i MY9 (CD33) (wszystkie z Coulter Immunology, Hialeah, Fla.). Mysią IgG1 skoniugowaną z fluoresceiną lub fikoerytryną zastosowano jako kontrolę ujemną. Limfocyty CD4 + lub CD8 + oczyszczono z nieprzylegających PBMC na perełkach immunomagnetycznych skoniugowanych z CD4 lub CD8 (Dynabeads M450, Dynal, Oslo, Norwegia).
Barwienie immunohistochemiczne
Biopsję wykonano szóstego dnia hospitalizacji, a skórę uzyskano z przedramienia w obszarze z wieloma rumieniowymi grudkami i plamkami. Fragmenty próbki barwiono wyżej wymienionymi przeciwciałami monoklonalnymi, zgodnie z metodą awidyna-biotyna-fosfataza alkaliczna22.
Badanie wirusowego antygenu
Antygen cytomegalowirusa zabarwiono metodą bezpośredniego immunoperoksydazy z ludzkim przeciwciałem monoklonalnym skoniugowanym z peroksydazą chrzanową, HRP-C723. Antygen HHV-6 badano specyficznym dla HHV-6 monoklonalnym przeciwciałem, OHV-2 (udostępnionym przez dr Yamanishi, Uniwersytet Osaka, Osaka, Japonia), 24 według metody awidyna-biotyna-fosfataza alkaliczna. OHV-2 może rozpoznać oba typy HHV-6.
Miareczkowanie przeciwciała anty-HHV-6
Próbki surowicy pacjenta poddano krioprezerwacji w temperaturze -80 ° C do momentu użycia. Miareczkowanie przeciwciała anty-HHV-6 przeprowadzono za pomocą pośredniego testu immunofluorescencyjnego, w którym jako antygen docelowy stosowano komórki MT-4 trwale zakażone HHV-6 (szczep HST), a surowicę kozią przeciwko IgG lub IgM sprzężoną z fluoresceiną stosowano jako wtórne przeciwciało. Aby wykryć IgM anty-HHV-6, IgG i IgA w surowicy zostały wchłonięte odpowiednio przez G186 i AR125. Te próbki były obsługiwane jednocześnie. Surowicę uzyskaną od pacjenta z aktywnym podtypem exanthem użyto jako kontrolę pozytywną.
Badanie DNA wirusa opryszczki za pomocą reakcji łańcuchowej polimerazy
DNA wirusa opryszczki wykryto metodą reakcji łańcuchowej polimerazy (PCR). Zastosowano następujące startery: do amplifikacji DNA HHV-6, 5 CCCATTTACGATTTCCTGCACCACCTCTCTGC3 i 5 TTCAGGGACCGTTATGTCATTGAGCATGTC3 (region białko-gen dużego segmentu); w przypadku wirusa cytomegalii, 5 GCAGAGCTCGTTTAGTGAACC3 i 5 GGCACGGGGAATCCGCGTTCC3 (główny bezpośredni wczesny region); w przypadku wirusa Epsteina-Barr, 5 CCAGAGGTAAGTGGACTT3 i 5 GACCGGTGCCTTCTTAGG3 (długi region wewnętrznej rewitalizacji); i dla wirusa opryszczki pospolitej, 5 CATCACCGACCCGGAGAGGGAC3 i 5 GGGCCAGGCGCTTCTTGGTGTA3 (region polimerazy DNA).
Genotypowanie HHV-6
Genotypowanie HHV-6 przeprowadzono zgodnie z Aubin i wsp. 5
[przypisy: psychoterapeuta ursynów, badanie krwi kwas moczowy cena, usg barku kraków ]

Dodaj komentarz